| Detail of EST/Unigene TCNB52144 |
| Acc. | TCNB52144 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Metallothionein-like protein type 2 OS=Nicotiana glutinosa E-value=4e-25; Metallothionein-like protein type 2 B OS=Solanum lycopersicum E-value=7e-24; Metallothionein-like protein type 2 OS=Actinidia deliciosa E-value=3e-16; Metallothionein-like protein type 2 OS=Ricinus communis E-value=4e-14; Metallothionein-like protein 1 OS=Coffea arabica E-value=6e-13; |
| Length | 620 nt |
| Species | Nicotiana benthamiana |
| Belonged EST Libraries | NB_SAL_US (33 ESTs); NB_TRI (4 ESTs); LIBEST_024542 (1 ESTs); |
| Sequence | GACATGGAAGTAAGTTCTTCAATTAGTTGAAACCAAACCACAAATACTCCCAAAACATAG |
| EST members of Unigene | CN743395 EX533644 CN743019 CN741438 CN742222 CN745180 CN747327 ES884719 CN746323 CN743767 CN744139 CN742959 CN742761 CN744733 CN744149 ES888628 CN744547 CN746697 CN748754 CN744056 CN745470 CN748215 CN746648 CN742330 CN742740 CN747246 CN748439 CN746670 ES887296 CN746054 CN746790 CN744066 CN745240 CN744656 CN746612 CN742897 CN745250 GO600233 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 820098 |
| Trichome-related Gene from Literature | 820098 |