Detail of EST/Unigene TCNB52195 |
Acc. | TCNB52195 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Metallothionein-like protein type 2 OS=Solanum lycopersicum E-value=3e-19; Metallothionein-like protein type 2 OS=Nicotiana plumbaginifolia E-value=2e-17; Metallothionein-like protein type 2 OS=Solanum lycopersicum E-value=5e-17; Metallothionein-like protein 1 OS=Mimulus guttatus E-value=2e-15; Metallothionein-like protein type 2 A OS=Solanum lycopersicum E-value=3e-15; |
Length | 534 nt |
Species | Nicotiana benthamiana |
Belonged EST Libraries | NB_SAL_US (68 ESTs); NB_TRI (39 ESTs); NB_GTISSUE (1 ESTs); |
Sequence | GGGCGATCTCAAATCACAAACTCTTTTTTGATCAATAGATTCCTAATCTTTTCCTAAGAA |
EST members of Unigene | CN745192 ES886450 CN745780 ES887150 CN742634 CN741448 CN744988 CN748908 ES886432 CN747319 CN743808 CN748107 CN742837 CN743231 ES886523 ES887855 CN747758 CN742260 CN745215 CN741858 CN742053 CN745792 EX533705 ES888406 ES887814 CN745197 CN743606 CN741436 CN747880 EX533622 CN743765 ES887713 CN746500 CN655175 CN747671 EH365571 ES889170 EX534135 CN743744 CN743775 CN745148 ES889716 CN741630 CN744972 ES887422 CN655420 CN655418 CN747302 ES888698 CN744573 ES888693 CN745157 CN747296 ES890040 ES888004 CN744894 ES884469 CN745481 CN743715 CN743123 ES889546 EX534072 CN742121 CN747219 ES884811 CN745861 ES886306 ES887627 ES889047 CN742156 CN743343 ES886649 ES887644 CN745492 CN742942 CN747638 CN745882 CN747238 CN743922 CN747044 CN747410 ES886869 ES887903 ES885143 CN745244 CN746801 CN742685 ES886201 ES885128 CN655491 CN655490 CN748168 ES885809 CN747387 CN655099 ES889486 EX534066 ES885524 CN742513 CN747211 CN742504 EX534047 CN741716 CN745257 EX534046 EX533777 CN745253 CN748781 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 831816 |
Trichome-related Gene from Literature | 831816 |