| Detail of EST/Unigene TCNT50957 |
| Acc. | TCNT50957 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 3-ketoacyl-CoA thiolase 2, peroxisomal OS=Arabidopsis thaliana E-value=0; 3-ketoacyl-CoA thiolase 1, peroxisomal OS=Arabidopsis thaliana E-value=0; 3-ketoacyl-CoA thiolase 5, peroxisomal OS=Arabidopsis thaliana E-value=0; 3-ketoacyl-CoA thiolase, peroxisomal OS=Homo sapiens E-value=0; 3-ketoacyl-CoA thiolase A, peroxisomal OS=Mus musculus E-value=0; |
| Length | 1705 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | |
| Sequence | GTAATCCACTAGCAATAACACCCCATTTCCATCTCTGTGTAAAGGAAGAAGAAGAAGAAA |
| EST members of Unigene | FG133211 FG185131 FG138093 EB438397 FG195778 FG136729 FG132791 FG195548 FS437560 FG133252 FG170605 FG202655 FG148281 FG165497 FG133772 FS409819 DW001820 FG199860 FG170539 FG193766 FG140667 FG185219 FS424066 FG141539 FG135562 FG191428 FG134548 FG134163 FG164888 FG138982 FG134850 FS402591 FG190251 DV158190 FS396477 FG186930 FG195638 FG199057 FG164826 FG184218 FG148205 FG198965 FS404011 FG190161 FG158995 FG155259 FG187017 FG167575 FG191341 FG195684 FG158934 FG148052 EH618687 FG202563 FG202831 FG134908 FG195328 FG195419 FG145103 FS416093 FG138282 FG202738 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00362 Benzoate degradation via hydroxylation > K07513 acetyl-CoA acyltransferase 1; Metabolism > Lipid Metabolism > ko00120 Bile acid biosynthesis > K07513 acetyl-CoA acyltransferase 1; Metabolism > Lipid Metabolism > ko01040 Biosynthesis of unsaturated fatty acids > K07513 acetyl-CoA acyltransferase 1; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K07513 acetyl-CoA acyltransferase 1; Metabolism > Amino Acid Metabolism > ko00280 Valine, leucine and isoleucine degradation > K07513 acetyl-CoA acyltransferase 1 |
| EC | 2.3.1.16 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 817876 |
| Trichome-related Gene from Literature | 817876 |