Detail of EST/Unigene TCNT53036 |
Acc. | TCNT53036 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Mitogen-activated protein kinase homolog NTF4 OS=Nicotiana tabacum E-value=0; Mitogen-activated protein kinase homolog MMK1 OS=Medicago sativa E-value=0; Mitogen-activated protein kinase homolog D5 OS=Pisum sativum E-value=0; Mitogen-activated protein kinase 6 OS=Arabidopsis thaliana E-value=0; Mitogen-activated protein kinase 1 OS=Oryza sativa subsp. japonica E-value=0; |
Length | 1629 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | LIBEST_024954 (2 ESTs); NT_AGN_RNC (2 ESTs); NT_AGN_PNL (2 ESTs); NT_AGN_ELP (1 ESTs); NT_TRI (1 ESTs); |
Sequence | GAAGTTGTTAATGAGAAAAGACAAAAGCAAAACAACAAACGGCCTTCGTGTTTCTCTTCA |
EST members of Unigene | FG172332 AM832764 FG193489 FG139145 FG133906 FG154693 FG623375 X83880 FG144068 FG149536 FG166145 FG137293 FG194237 FG143190 FG196748 FG153064 FG149462 FG182695 FG154633 FG153121 FG638641 FG147338 FG146629 DQ229078 FG147490 FG170472 FG182786 FG196836 FG194327 DQ229077 FS407796 FG133979 FG172395 FS429614 FG133228 AM840190 FG143726 FG166222 FG170523 FG167201 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04371 extracellular signal-regulated kinase 1/2; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04371 extracellular signal-regulated kinase 1/2; Environmental Information Processing > Signal Transduction > ko04150 mTOR signaling pathway > K04371 extracellular signal-regulated kinase 1/2; Environmental Information Processing > Signal Transduction > ko04350 TGF-beta signaling pathway > K04371 extracellular signal-regulated kinase 1/2; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04371 extracellular signal-regulated kinase 1/2 |
EC | 2.7.11.24 |
Transcription Factor Family | WRKY |
Transporter Classification Family | 1.A.2 Animal inward-rectifier K+ channel IRK-C; 1.A.26 Plant plasmodesmata PPD |
Probeset |
|
Corresponding NCBI Gene | 818982 |
Trichome-related Gene from Literature | 818982 |