Detail of EST/Unigene TCNT54220 |
Acc. | TCNT54220 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 16, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=0; Chlorophyll a-b binding protein C, chloroplastic OS=Nicotiana plumbaginifolia E-value=0; |
Length | 1069 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_NNT (4 ESTs); LIBEST_024954 (1 ESTs); |
Sequence | GGCGCGGGGGACACAGCTAACTTCTCTATTACTTCAGCCATAAAAAAAACACTTCTTTCT |
EST members of Unigene | CV017718 CV021777 FS425817 AM808257 FG623606 DV159636 DV998800 FG185045 EB443091 DV162587 CV019667 DV162590 CV016967 FS431855 DW000593 EB438253 EH613981 EB438384 EB441680 FS398540 FS417110 CV018997 FS385846 CV019773 CV016490 FS405986 CV017848 FG632434 FG624265 CV018433 EB447443 EB447445 EB436802 CV018261 FG632389 DV998796 FS419596 FS383320 FS435698 EH614023 FS378803 FS376805 EB427919 EB431426 EB435797 EB435799 EB435211 EB429269 EH614047 CV020330 FS394532 EH614054 CV020915 X52744 EB434597 CV021613 EH613985 FS415939 EB437281 CV021044 FG198281 EH613996 FG184954 EB447543 FS411761 EB679916 FS437428 CV018547 FS386753 FG631733 FG198187 CV019892 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839871 |
Trichome-related Gene from Literature | 839871 |