| Detail of EST/Unigene TCNT58963 |
| Acc. | TCNT58963 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Farnesyl pyrophosphate synthase 1 OS=Lupinus albus E-value=0; Farnesyl pyrophosphate synthase 2 OS=Lupinus albus E-value=0; Farnesyl pyrophosphate synthase 2 OS=Parthenium argentatum E-value=0; Farnesyl pyrophosphate synthase OS=Artemisia annua E-value=0; Farnesyl diphosphate synthase 1 OS=Artemisia spiciformis E-value=0; |
| Length | 1323 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | NT_KF8 (2 ESTs); NT_AGN_RNC (2 ESTs); LIBEST_024954 (2 ESTs); LIBEST_023330 (2 ESTs); NT_CHO_SL (1 ESTs); NT_DL (1 ESTs); NT_EITL (1 ESTs); MT_CDS (1 ESTs); |
| Sequence | GAATACACAATTCTCCTACTCTGAAAGTAACGAACATTCATTCCAACAATATGAGTAATC |
| EST members of Unigene | EG649700 FG623648 NTU97330 FG166692 FS394478 EH618695 FS428584 FG166761 FG623613 EB426351 EB424986 AM824251 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00900 Terpenoid biosynthesis > K00787 dimethylallyltranstransferase; Metabolism > Lipid Metabolism > ko00100 Biosynthesis of steroids > K00787 dimethylallyltranstransferase; Metabolism > Biosynthesis of Secondary Metabolites > ko00900 Terpenoid biosynthesis > K00795 geranyltranstransferase; Metabolism > Lipid Metabolism > ko00100 Biosynthesis of steroids > K00795 geranyltranstransferase |
| EC | 2.5.1.1 2.5.1.10 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827430 |
| Trichome-related Gene from Literature | 827430 |