Detail of EST/Unigene TCNT59039 |
Acc. | TCNT59039 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Cysteine synthase OS=Solanum tuberosum E-value=0; Cysteine synthase OS=Citrullus lanatus E-value=0; Cysteine synthase OS=Spinacia oleracea E-value=0; Cysteine synthase OS=Oryza sativa subsp. japonica E-value=0; Cysteine synthase OS=Zea mays E-value=0; |
Length | 1314 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_AGN_RNC (14 ESTs); LIBEST_024954 (7 ESTs); NT_NNT (4 ESTs); LIBEST_026713 (2 ESTs); NT_AGN_PNL (2 ESTs); LIBEST_023330 (2 ESTs); NT_KR3B (1 ESTs); NT_AGN_RPC (1 ESTs); NT_EITL (1 ESTs); NT_MAT005 (1 ESTs); LIBEST_026761 (1 ESTs); NT_AGN_ELP (1 ESTs); NT_CHO_SL (1 ESTs); MT_CDS (1 ESTs); NT_MAT001 (1 ESTs); NT_KN6B (1 ESTs); |
Sequence | AACATAGTCACCGTACATTTGCATTCTAGTACCAATCCATCTTCAACCAGGCTCCTTTCT |
EST members of Unigene | FG152418 FG149783 FG182632 HS082597 FG158053 FG175680 FS419198 FG182542 CV021560 EB439357 FG152717 HO840890 FG154660 FS404343 FG158483 FG158552 EG650413 FG145391 CV020958 FG173253 FS410776 FG135627 FG629945 EH620691 BP530875 FG176018 CV018198 FG152653 HO841443 FG149855 FG628115 AM087458 FG154708 BP137167 EB683196 FS415954 FS408018 FS408762 FG152362 FS431887 CV018757 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00260 Glycine, serine and threonine metabolism > K01697 cystathionine beta-synthase; Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K01697 cystathionine beta-synthase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K01697 cystathionine beta-synthase; Metabolism > Energy Metabolism > ko00920 Sulfur metabolism > K01738 cysteine synthase; Metabolism > Amino Acid Metabolism > ko00272 Cysteine metabolism > K01738 cysteine synthase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K01738 cysteine synthase |
EC | 2.5.1.47 4.2.1.22 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827145 |
Trichome-related Gene from Literature | 827145 |