| Detail of EST/Unigene TCNT59953 |
| Acc. | TCNT59953 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 16, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein E, chloroplastic OS=Nicotiana plumbaginifolia E-value=0; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=0; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=0; |
| Length | 1092 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | NT_NNT (19 ESTs); LIBEST_024954 (6 ESTs); LIBEST_023330 (6 ESTs); NT_AGN_ELP (5 ESTs); NB_BL12 (5 ESTs); NT_KN6B (3 ESTs); NT_KL5B (2 ESTs); NT_KT7 (2 ESTs); NT_KP1BS (2 ESTs); NT_KF8 (1 ESTs); NT_COL (1 ESTs); NT_KL4B (1 ESTs); NT_TL13 (1 ESTs); |
| Sequence | GACAACTAACTTCTCTATTACTTCAGCCATCAAAAAACACTTCTTTCTCCTTATTAAACC |
| EST members of Unigene | CV015944 FG135156 EB447469 CV019236 DV998788 FG625761 CV019631 EB437030 FS393356 EB447490 FG630879 FG623092 EB429131 FG629178 FG627745 CV016092 FG135295 EB427952 FG136291 CV015919 EB434476 AM800555 FG134100 CV020760 CV019022 FS394330 EB437248 CV018210 CV020491 CV020685 CV020690 CV019535 EB437326 FS419580 EB438126 EB437934 CV018009 DV160156 FS373287 FG628309 EB681885 FS411385 CV016953 EB438431 FG133456 CV020633 CV020827 EB437069 EB432539 CV018736 EB437096 FS423682 CV018142 CV020845 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839871 |
| Trichome-related Gene from Literature | 839871 |