Detail of EST/Unigene TCNT60101 |
Acc. | TCNT60101 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 16, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=0; Chlorophyll a-b binding protein C, chloroplastic OS=Nicotiana plumbaginifolia E-value=0; |
Length | 1064 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | LIBEST_024954 (30 ESTs); NT_NNT (14 ESTs); NT_KL4B (6 ESTs); NT_AGN_PNL (6 ESTs); NT_KP1BS (5 ESTs); NT_KL5B (4 ESTs); NT_KT7 (4 ESTs); NT_KN6B (4 ESTs); NT_TL13 (3 ESTs); NB_BL12 (2 ESTs); NT_AGN_ELP (1 ESTs); LIBEST_023330 (1 ESTs); |
Sequence | GACCACAGCTAACATCTCTATTACTTCAGCCATCAAAAAAACACTTACTTCTCCTTGCTA |
EST members of Unigene | FS429589 EB447495 EB438219 FS432219 DV998818 DV999011 EB442290 CV018093 CV018884 CV020238 FS434131 EB435743 EB429212 EB433008 DV999052 FS377928 EB682233 FS438171 FS396622 DV998814 FS425515 FS424260 EB447440 EB437375 FS382405 FG180786 CV021513 FS376515 EB437159 EB447650 FG194751 CV016344 EB435876 FS375916 FS408669 FS409153 DV162342 CV020967 FS408201 FS376833 FS396745 FS392234 FG139707 CV021279 CV020118 FG194843 FG632446 FS407735 FS422944 CV021087 FS381170 FS386550 EB682122 CV019559 CV018207 FS400403 FS406854 EB447587 FG183069 FG180694 EB429253 FS419231 CV018544 FS373677 FS392436 FG183160 EB438082 CV021243 DV999060 EB682659 FS412988 DV161470 FS383974 FS399741 EB429250 FS412375 DV999086 EB429238 EB438287 CV017972 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839871 |
Trichome-related Gene from Literature | 839871 |