| Detail of EST/Unigene TCNT60530 |
| Acc. | TCNT60530 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutathione S-transferase OS=Hyoscyamus muticus E-value=0; Glutathione S-transferase APIC OS=Nicotiana tabacum E-value=2e-85; Glutathione S-transferase PARB OS=Nicotiana tabacum E-value=4e-84; Glutathione S-transferase F8, chloroplastic OS=Arabidopsis thaliana E-value=1e-69; Glutathione S-transferase OS=Silene vulgaris E-value=5e-65; |
| Length | 992 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | NT_KL4B (3 ESTs); NT_CHO_SL (2 ESTs); NT_KL5B (2 ESTs); NT_KR3B (2 ESTs); LIBEST_024954 (2 ESTs); NT_TRI (1 ESTs); NT_K326_LSL (1 ESTs); NT_KT7 (1 ESTs); NT_KP1BS (1 ESTs); NT_KF8 (1 ESTs); NT_EITL (1 ESTs); NT_SL (1 ESTs); LIBEST_023330 (1 ESTs); |
| Sequence | ATCATTCCACGTTTAATTTCTAACACAAATTATTCATTAAAGTTCTCTCTCTCTCTCCTC |
| EST members of Unigene | EG650450 FG640369 EH619405 EB680201 FS383744 EH623484 DW001986 FS391345 DV999996 EB430757 EB431742 FG630646 FG645066 AM806011 EB450266 EB683380 DV999635 DV161052 EB425721 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
| EC | 2.5.1.18 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 819386 |
| Trichome-related Gene from Literature | 819386 |