Detail of EST/Unigene TCNT62831 |
Acc. | TCNT62831 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Farnesyl pyrophosphate synthase 1 OS=Lupinus albus E-value=2e-96; Farnesyl pyrophosphate synthase OS=Helianthus annuus E-value=5e-96; Farnesyl pyrophosphate synthase 2 OS=Lupinus albus E-value=1e-95; Farnesyl pyrophosphate synthase OS=Artemisia annua E-value=2e-95; Farnesyl pyrophosphate synthase 2 OS=Parthenium argentatum E-value=2e-95; |
Length | 793 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | LIBEST_024954 (15 ESTs); NT_CHO_SL (1 ESTs); NT_EST_CSP (1 ESTs); NT_TRI_K326 (1 ESTs); |
Sequence | CTGGCGCTTACTGCTGGAGTCTGGACTGCTCTCTACTCCGTGCAACTTCTATGACTCTCC |
EST members of Unigene | FS416885 FS435400 FS395180 EH619433 FS406136 FS383434 FG641171 FS401856 FS380232 FS382501 FS395723 FS380518 FS406860 FS379781 FS424162 FS404261 FS396253 EH614764 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00900 Terpenoid biosynthesis > K00787 dimethylallyltranstransferase; Metabolism > Lipid Metabolism > ko00100 Biosynthesis of steroids > K00787 dimethylallyltranstransferase; Metabolism > Biosynthesis of Secondary Metabolites > ko00900 Terpenoid biosynthesis > K00795 geranyltranstransferase; Metabolism > Lipid Metabolism > ko00100 Biosynthesis of steroids > K00795 geranyltranstransferase |
EC | 2.5.1.1 2.5.1.10 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827430 |
Trichome-related Gene from Literature | 827430 |