| Detail of EST/Unigene TCNT65469 |
| Acc. | TCNT65469 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Metallothionein-like protein type 3 OS=Malus domestica E-value=3e-13; Metallothionein-like protein type 3 OS=Carica papaya E-value=5e-13; Metallothionein-like protein type 3 OS=Actinidia deliciosa E-value=1e-12; Metallothionein-like protein type 3 OS=Musa acuminata E-value=2e-12; Metallothionein-like protein 1 OS=Prunus avium E-value=3e-09; |
| Length | 524 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | LIBEST_024954 (5 ESTs); NT_KL5B (4 ESTs); NT_KL4B (4 ESTs); NT_CHO_SL (3 ESTs); LIBEST_023330 (2 ESTs); NT_KN6B (2 ESTs); NT_KF8 (1 ESTs); NT_SL (1 ESTs); NT_LTRI3 (1 ESTs); NT_TRI (1 ESTs); NT_K326_LSL (1 ESTs); NT_KT7 (1 ESTs); NT_TL13 (1 ESTs); |
| Sequence | GAAGCAATAGAAAATTTACAACTGACACTTTCTCCTATTTAAGTAAAACTCTATTTCAAT |
| EST members of Unigene | EB429326 AM790865 FS414982 EB431510 FS431431 EB429516 EB441467 FS389273 DW000701 EB426211 DW000696 EB448774 FS429179 EH623934 EB681229 EH618173 EH622270 FG636450 EB430826 EB681099 FG627699 FG639190 EB442318 FS412696 EB434748 FG627424 FG643510 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 820771 |
| Trichome-related Gene from Literature | 820771 |