| Detail of EST/Unigene TCOB40149 |
| Acc. | TCOB40149 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Trans-cinnamate 4-monooxygenase OS=Vigna radiata var. radiata E-value=0; Trans-cinnamate 4-monooxygenase OS=Glycine max E-value=0; Trans-cinnamate 4-monooxygenase OS=Glycyrrhiza echinata E-value=0; Trans-cinnamate 4-monooxygenase OS=Populus kitakamiensis E-value=0; Trans-cinnamate 4-monooxygenase OS=Catharanthus roseus E-value=0; |
| Length | 1772 nt |
| Species | Ocimum basilicum |
| Belonged EST Libraries | OB_MEa (32 ESTs); OB_SEb (12 ESTs); OB_EEa (8 ESTs); |
| Sequence | GCAATTTACAGAAAACCATGTTTACCACATTGCTGGCTGTCGCCTTGCTCTCATGCGCTA |
| EST members of Unigene | DY344444 DY344443 DY344180 DY343662 DY343361 DY343360 DY343060 DY342463 DY342358 DY342357 DY340770 DY340747 DY334417 DY334308 DY333845 DY333694 DY333642 DY333565 DY332950 DY332930 DY332802 DY332730 DY332729 DY332053 DY331896 DY331836 DY331821 DY331053 DY331052 DY330899 DY330638 DY330631 DY330475 DY330414 DY330119 DY329974 DY329850 DY329849 DY328756 DY328405 DY328313 DY327977 DY327140 DY327139 DY326278 DY326277 DY325890 DY325364 DY325363 DY325041 DY321449 DY321448 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Biosynthesis of Secondary Metabolites > ko00232 Caffeine metabolism > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07 |
| EC | 1.14.14.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 817599 |
| Trichome-related Gene from Literature | 817599 |