| Detail of EST/Unigene TCOB40199 |
| Acc. | TCOB40199 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable 1-deoxy-D-xylulose-5-phosphate synthase 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=0; 1-deoxy-D-xylulose-5-phosphate synthase 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=0; 1-deoxy-D-xylulose-5-phosphate synthase, chloroplastic OS=Arabidopsis thaliana E-value=0; Probable 1-deoxy-D-xylulose-5-phosphate synthase, chloroplastic OS=Capsicum annuum E-value=0; 1-deoxy-D-xylulose-5-phosphate synthase OS=Rhodospirillum centenum (strain ATCC 51521 / SW) E-value=0; |
| Length | 2054 nt |
| Species | Ocimum basilicum |
| Belonged EST Libraries | OB_SEa (30 ESTs); OB_MEa (28 ESTs); OB_SEb (16 ESTs); OB_EEa (7 ESTs); |
| Sequence | GTTTTTTTATAAGAATGGAATAGATGATTTTCATTAAATAAAAGTATAAATGGAATTATT |
| EST members of Unigene | DY342970 DY342640 DY342639 DY342590 DY342589 DY342566 DY342242 DY342115 DY342114 DY341879 DY341878 DY340866 DY340865 DY340598 DY340430 DY340065 DY339830 DY339673 DY339502 DY339501 DY339439 DY339438 DY339199 DY339017 DY338990 DY338547 DY338546 DY338334 DY338331 DY337907 DY337887 DY337855 DY337827 DY337724 DY337723 DY337532 DY337531 DY337166 DY335256 DY335255 DY335122 DY335121 DY334776 DY334775 DY334630 DY334629 DY334186 DY333684 DY333683 DY333307 DY333188 DY333187 DY332306 DY332305 DY332258 DY330849 DY330848 DY330493 DY329371 DY329370 DY329115 DY329114 DY329093 DY329092 DY329081 DY328888 DY328874 DY327811 DY327810 DY327646 DY327645 DY327544 DY327543 DY327301 DY326757 DY326756 DY325005 DY324471 DY324470 DY324439 DY322992 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00030 Pentose phosphate pathway > K00615 transketolase; Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K00615 transketolase; Metabolism > Biosynthesis of Polyketides and Nonribosomal Peptides > ko01051 Biosynthesis of ansamycins > K00615 transketolase |
| EC | 2.2.1.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827230 |
| Trichome-related Gene from Literature | 827230 |