Detail of EST/Unigene TCOB40325 |
Acc. | TCOB40325 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Aldehyde dehydrogenase family 2 member C4 OS=Arabidopsis thaliana E-value=0; Aldehyde dehydrogenase family 2 member B4, mitochondrial OS=Arabidopsis thaliana E-value=8e-86; Aldehyde dehydrogenase family 2 member B7, mitochondrial OS=Arabidopsis thaliana E-value=3e-81; Retinal dehydrogenase 1 OS=Mesocricetus auratus E-value=2e-74; Retinal dehydrogenase 1 OS=Ovis aries E-value=3e-74; |
Length | 910 nt |
Species | Ocimum basilicum |
Belonged EST Libraries | OB_SEa (2 ESTs); OB_MEa (2 ESTs); OB_SEb (1 ESTs); |
Sequence | GCCTGTTTTTGAGAGAATACCAAAAAAGCAAGGTGTGAAGGATAGAGGCAGAGGCAGTAT |
EST members of Unigene | DY342828 DY339353 DY334441 DY332608 DY329928 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00903 Limonene and pinene degradation > K00128 aldehyde dehydrogenase (NAD+); Metabolism > Xenobiotics Biodegradation and Metabolism > ko00631 1,2-Dichloroethane degradation > K00128 aldehyde dehydrogenase (NAD+); Metabolism > Xenobiotics Biodegradation and Metabolism > ko00641 3-Chloroacrylic acid degradation > K00128 aldehyde dehydrogenase (NAD+); Metabolism > Carbohydrate Metabolism > ko00053 Ascorbate and aldarate metabolism > K00128 aldehyde dehydrogenase (NAD+); Metabolism > Carbohydrate Metabolism > ko00650 Butanoate metabolism > K00128 aldehyde dehydrogenase (NAD+); Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00128 aldehyde dehydrogenase (NAD+); Metabolism > Carbohydrate Metabolism > ko00640 Propanoate metabolism > K00128 aldehyde dehydrogenase (NAD+); Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K00128 aldehyde dehydrogenase (NAD+); Metabolism > Lipid Metab |
EC | 1.2.1.3 1.2.1.36 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 822042 |
Trichome-related Gene from Literature | 822042 |