| Detail of EST/Unigene TCOB40780 |
| Acc. | TCOB40780 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable 1-deoxy-D-xylulose-5-phosphate synthase 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=0; 1-deoxy-D-xylulose-5-phosphate synthase 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=0; 1-deoxy-D-xylulose-5-phosphate synthase, chloroplastic OS=Arabidopsis thaliana E-value=0; Probable 1-deoxy-D-xylulose-5-phosphate synthase, chloroplastic OS=Capsicum annuum E-value=0; 1-deoxy-D-xylulose-5-phosphate synthase OS=Brucella abortus (strain 2308) E-value=9e-74; |
| Length | 918 nt |
| Species | Ocimum basilicum |
| Belonged EST Libraries | OB_MEa (15 ESTs); OB_SEb (13 ESTs); OB_SEa (9 ESTs); OB_EEa (9 ESTs); |
| Sequence | ATAAGAGCATTAATATATATGAATGTAAGAATATGATTTAATAAAACGTATGAAGCGATT |
| EST members of Unigene | DY343068 DY342945 DY342944 DY342588 DY342500 DY342299 DY341968 DY341880 DY341582 DY341419 DY341017 DY341016 DY339944 DY339627 DY339325 DY338215 DY338214 DY337671 DY337626 DY337337 DY335544 DY335498 DY333774 DY333622 DY332790 DY331528 DY331162 DY330156 DY330141 DY329934 DY329933 DY329860 DY329859 DY329199 DY328997 DY328416 DY327123 DY326782 DY325872 DY325621 DY325620 DY324518 DY323508 DY323338 DY323337 DY321935 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00030 Pentose phosphate pathway > K00615 transketolase; Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K00615 transketolase; Metabolism > Biosynthesis of Polyketides and Nonribosomal Peptides > ko01051 Biosynthesis of ansamycins > K00615 transketolase |
| EC | 2.2.1.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827230 |
| Trichome-related Gene from Literature | 827230 |