| Detail of EST/Unigene TCSA11424 |
| Acc. | TCSA11424 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable 1-deoxy-D-xylulose-5-phosphate synthase 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=0; 1-deoxy-D-xylulose-5-phosphate synthase 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=0; Probable 1-deoxy-D-xylulose-5-phosphate synthase, chloroplastic OS=Capsicum annuum E-value=0; 1-deoxy-D-xylulose-5-phosphate synthase, chloroplastic OS=Arabidopsis thaliana E-value=0; 1-deoxy-D-xylulose-5-phosphate synthase OS=Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182) E-value=7e-84; |
| Length | 1102 nt |
| Species | Solanum arcanum |
| Belonged EST Libraries | SRR027943 (60 ESTs); |
| Sequence | TAGAGACCGAGGCGGCCGACATGTTTTGTTTTTTTTCTTTTTTTTTGAAGAACTAATATT |
| EST members of Unigene | SRR027943.416255 SRR027943.77964 SRR027943.221112 SRR027943.173244 SRR027943.432111 SRR027943.262556 SRR027943.398437 SRR027943.244565 SRR027943.481716 SRR027943.431305 SRR027943.363537 SRR027943.70460 SRR027943.257585 SRR027943.158901 SRR027943.385098 SRR027943.396881 SRR027943.243221 SRR027943.281528 SRR027943.377140 SRR027943.259452 SRR027943.473565 SRR027943.168002 SRR027943.134697 SRR027943.219196 SRR027943.105284 SRR027943.313311 SRR027943.229336 SRR027943.394951 SRR027943.33133 SRR027943.229523 SRR027943.13439 SRR027943.111373 SRR027943.315019 SRR027943.244046 SRR027943.94173 SRR027943.108877 SRR027943.8780 SRR027943.254761 SRR027943.437089 SRR027943.280776 SRR027943.47168 SRR027943.344994 SRR027943.156465 SRR027943.171363 SRR027943.421418 SRR027943.327507 SRR027943.251961 SRR027943.402036 SRR027943.48965 SRR027943.179603 SRR027943.359789 SRR027943.323250 SRR027943.56672 SRR027943.407418 SRR027943.326206 SRR027943.255608 SRR027943.489717 SRR027943.47623 SRR027943.476591 SRR027943.13958 SRR027943.290663 SRR027943.23225 SRR027943.100662 SRR027943.217526 SRR027943.94774 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00030 Pentose phosphate pathway > K00615 transketolase; Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K00615 transketolase; Metabolism > Biosynthesis of Polyketides and Nonribosomal Peptides > ko01051 Biosynthesis of ansamycins > K00615 transketolase |
| EC | 2.2.1.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827230 |
| Trichome-related Gene from Literature | 827230 |