Detail of EST/Unigene TCSA11488 |
Acc. | TCSA11488 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 40S ribosomal protein S13 OS=Glycine max E-value=6e-56; 40S ribosomal protein S13-2 OS=Arabidopsis thaliana E-value=2e-55; 40S ribosomal protein S13-1 OS=Arabidopsis thaliana E-value=2e-55; 40S ribosomal protein S13 OS=Pisum sativum E-value=2e-54; 40S ribosomal protein S13-2 OS=Oryza sativa subsp. japonica E-value=8e-51; |
Length | 678 nt |
Species | Solanum arcanum |
Belonged EST Libraries | SRR027943 (9 ESTs); |
Sequence | TAGAGACCGAGGCGGCCGACATGTTTTGTTTTTTTTCTTTTTTTTTCAGTACCAGAGCGG |
EST members of Unigene | SRR027943.485049 SRR027943.234192 SRR027943.144268 SRR027943.466710 SRR027943.343746 SRR027943.124096 SRR027943.251529 SRR027943.201020 SRR027943.219774 SRR027943.445239 SRR027943.296258 SRR027943.69557 SRR027943.7340 SRR027943.353317 SRR027943.182391 SRR027943.29331 SRR027943.321590 SRR027943.474958 SRR027943.385595 SRR027943.42236 SRR027943.27295 SRR027943.235457 SRR027943.418109 SRR027943.363475 SRR027943.169482 SRR027943.329934 SRR027943.174939 SRR027943.31069 SRR027943.316354 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Translation > ko03010 Ribosome > K02953 small subunit ribosomal protein S13e |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 828167 |
Trichome-related Gene from Literature | 828167 |