| Detail of EST/Unigene TCSA11489 |
| Acc. | TCSA11489 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 40S ribosomal protein S13 OS=Glycine max E-value=6e-56; 40S ribosomal protein S13-2 OS=Arabidopsis thaliana E-value=2e-55; 40S ribosomal protein S13-1 OS=Arabidopsis thaliana E-value=2e-55; 40S ribosomal protein S13 OS=Pisum sativum E-value=2e-54; 40S ribosomal protein S13-2 OS=Oryza sativa subsp. japonica E-value=6e-51; |
| Length | 562 nt |
| Species | Solanum arcanum |
| Belonged EST Libraries | SRR027943 (1 ESTs); |
| Sequence | TGGTAAGATCGACTACTAACATAAGCAGCCAAGATTTGAATATATGACATCTAAAGAAAG |
| EST members of Unigene | SRR027943.144268 SRR027943.490557 SRR027943.466710 SRR027943.343746 SRR027943.251529 SRR027943.219774 SRR027943.296258 SRR027943.69557 SRR027943.7340 SRR027943.234192 SRR027943.485049 SRR027943.182391 SRR027943.385595 SRR027943.27295 SRR027943.235457 SRR027943.418109 SRR027943.363475 SRR027943.316354 SRR027943.174939 SRR027943.329934 SRR027943.29331 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Translation > ko03010 Ribosome > K02953 small subunit ribosomal protein S13e |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 828167 |
| Trichome-related Gene from Literature | 828167 |