| Detail of EST/Unigene TCSA12124 |
| Acc. | TCSA12124 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Delta(24)-sterol reductase OS=Pisum sativum E-value=0; Delta(24)-sterol reductase OS=Arabidopsis thaliana E-value=0; Delta(24)-sterol reductase OS=Rattus norvegicus E-value=0; Delta(24)-sterol reductase OS=Macaca fascicularis E-value=0; Delta(24)-sterol reductase OS=Homo sapiens E-value=0; |
| Length | 1976 nt |
| Species | Solanum arcanum |
| Belonged EST Libraries | SRR027943 (99 ESTs); |
| Sequence | GATCCTTGCATCTCAGGGTGACGCCAAATTCCACTTGGCAGTTCTGTTTGGCCTCTCTTG |
| EST members of Unigene | SRR027943.125033 SRR027943.160097 SRR027943.119360 SRR027943.439330 SRR027943.239868 SRR027943.195339 SRR027943.441098 SRR027943.493315 SRR027943.367287 SRR027943.395709 SRR027943.147010 SRR027943.427775 SRR027943.314644 SRR027943.386083 SRR027943.459630 SRR027943.305995 SRR027943.494673 SRR027943.94241 SRR027943.401170 SRR027943.345678 SRR027943.91093 SRR027943.308946 SRR027943.268842 SRR027943.59236 SRR027943.193779 SRR027943.358078 SRR027943.225047 SRR027943.57137 SRR027943.51635 SRR027943.45350 SRR027943.403393 SRR027943.396526 SRR027943.464986 SRR027943.491184 SRR027943.278767 SRR027943.32964 SRR027943.114307 SRR027943.365549 SRR027943.144473 SRR027943.78769 SRR027943.356699 SRR027943.151906 SRR027943.147403 SRR027943.220540 SRR027943.401602 SRR027943.74254 SRR027943.347685 SRR027943.274202 SRR027943.411038 SRR027943.308343 SRR027943.424728 SRR027943.307293 SRR027943.129077 SRR027943.52485 SRR027943.432793 SRR027943.407171 SRR027943.363069 SRR027943.326552 SRR027943.450395 SRR027943.114384 SRR027943.148663 SRR027943.239758 SRR027943.356571 SRR027943.322165 SRR027943.354396 SRR027943.145111 SRR027943.278979 SRR027943.9544 SRR027943.425915 SRR027943.4780 SRR027943.111787 SRR027943.93161 SRR027943.53060 SRR027943.109464 SRR027943.379946 SRR027943.274289 SRR027943.448077 SRR027943.13563 SRR027943.454925 SRR027943.459813 SRR027943.43490 SRR027943.144219 SRR027943.291456 SRR027943.343283 SRR027943.396638 SRR027943.235917 SRR027943.480504 SRR027943.481671 SRR027943.91251 SRR027943.263648 SRR027943.364464 SRR027943.160421 SRR027943.451188 SRR027943.33030 SRR027943.74160 SRR027943.135369 SRR027943.224554 SRR027943.287892 SRR027943.377222 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00100 Biosynthesis of steroids > K09828 delta24-sterol reductase |
| EC | 1.3.1.- 1.3.1.72 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 821519 |
| Trichome-related Gene from Literature | 821519 |