Detail of EST/Unigene TCSA12422 |
Acc. | TCSA12422 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 3-ketoacyl-CoA synthase 6 OS=Arabidopsis thaliana E-value=0; 3-ketoacyl-CoA synthase 5 OS=Arabidopsis thaliana E-value=0; 3-ketoacyl-CoA synthase 4 OS=Arabidopsis thaliana E-value=0; 3-ketoacyl-CoA synthase 9 OS=Arabidopsis thaliana E-value=0; 3-ketoacyl-CoA synthase 19 OS=Arabidopsis thaliana E-value=0; |
Length | 1134 nt |
Species | Solanum arcanum |
Belonged EST Libraries | SRR027943 (53 ESTs); |
Sequence | CTGCTAGAAATGAAGCTGAAGTTGTTATATTCTCTGCTATTGATGACTTGATGAAGAAAA |
EST members of Unigene | SRR027943.70504 SRR027943.99958 SRR027943.136433 SRR027943.146 SRR027943.168353 SRR027943.390431 SRR027943.99161 SRR027943.410588 SRR027943.359233 SRR027943.91104 SRR027943.41952 SRR027943.386686 SRR027943.46307 SRR027943.277746 SRR027943.135690 SRR027943.405753 SRR027943.68956 SRR027943.46916 SRR027943.271644 SRR027943.248356 SRR027943.409254 SRR027943.61655 SRR027943.117238 SRR027943.12261 SRR027943.438969 SRR027943.145689 SRR027943.282052 SRR027943.174666 SRR027943.441391 SRR027943.436305 SRR027943.64475 SRR027943.97894 SRR027943.286097 SRR027943.380119 SRR027943.145717 SRR027943.2216 SRR027943.110212 SRR027943.113552 SRR027943.292352 SRR027943.178617 SRR027943.184488 SRR027943.481902 SRR027943.45868 SRR027943.284775 SRR027943.158490 SRR027943.175130 SRR027943.20856 SRR027943.376632 SRR027943.243136 SRR027943.6222 SRR027943.185285 SRR027943.419886 SRR027943.196423 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 843182 |
Trichome-related Gene from Literature | 843182 |