| Detail of EST/Unigene TCSA12468 |
| Acc. | TCSA12468 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | V-type proton ATPase subunit C OS=Arabidopsis thaliana E-value=0; V-type proton ATPase subunit C OS=Hordeum vulgare E-value=1e-80; V-type proton ATPase subunit C 1-B OS=Danio rerio E-value=6e-59; V-type proton ATPase subunit C 1-A OS=Danio rerio E-value=4e-58; V-type proton ATPase subunit C OS=Manduca sexta E-value=3e-57; |
| Length | 1083 nt |
| Species | Solanum arcanum |
| Belonged EST Libraries | SRR027943 (25 ESTs); |
| Sequence | ATTTTTTTTTTGTTTCTCAATACGTAGCAAAATATCTTTAAAATTTTCAGCAAGAGTTGG |
| EST members of Unigene | SRR027943.125624 SRR027943.434635 SRR027943.76205 SRR027943.287184 SRR027943.387894 SRR027943.426840 SRR027943.38255 SRR027943.36691 SRR027943.367517 SRR027943.76257 SRR027943.220386 SRR027943.21100 SRR027943.422878 SRR027943.145599 SRR027943.182294 SRR027943.55216 SRR027943.143172 SRR027943.75112 SRR027943.219059 SRR027943.33796 SRR027943.349517 SRR027943.178446 SRR027943.100087 SRR027943.360169 SRR027943.175935 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Energy Metabolism > ko00190 Oxidative phosphorylation > K02148 V-type H+-transporting ATPase subunit C |
| EC | 3.6.3.14 |
| Transcription Factor Family | |
| Transporter Classification Family | 3.A.2 H+- or Na+-translocating F-type, V-type and A-type ATPase superfamily F-ATPase |
| Probeset |
|
| Corresponding NCBI Gene | 837840 |
| Trichome-related Gene from Literature | 837840 |