Detail of EST/Unigene TCSA12528 |
Acc. | TCSA12528 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Glutathione S-transferase OS=Hyoscyamus muticus E-value=0; Glutathione S-transferase APIC OS=Nicotiana tabacum E-value=1e-82; Glutathione S-transferase PARB OS=Nicotiana tabacum E-value=1e-81; Glutathione S-transferase F8, chloroplastic OS=Arabidopsis thaliana E-value=2e-70; Glutathione S-transferase F2 OS=Arabidopsis thaliana E-value=7e-65; |
Length | 1037 nt |
Species | Solanum arcanum |
Belonged EST Libraries | SRR027943 (34 ESTs); |
Sequence | GATCATTCCACGTTTTCTCACATCTCACACACAAATTTCATTTTCTACTTTCACTTTCTC |
EST members of Unigene | SRR027943.99766 SRR027943.182236 SRR027943.445793 SRR027943.230671 SRR027943.452816 SRR027943.393935 SRR027943.183591 SRR027943.156995 SRR027943.183230 SRR027943.22136 SRR027943.20565 SRR027943.218426 SRR027943.40635 SRR027943.231697 SRR027943.292925 SRR027943.388321 SRR027943.277100 SRR027943.189236 SRR027943.312361 SRR027943.489051 SRR027943.494781 SRR027943.203609 SRR027943.70599 SRR027943.238222 SRR027943.461932 SRR027943.296334 SRR027943.128909 SRR027943.47235 SRR027943.248482 SRR027943.137553 SRR027943.125194 SRR027943.391742 SRR027943.105585 SRR027943.487147 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
EC | 2.5.1.18 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 819386 |
Trichome-related Gene from Literature | 819386 |