| Detail of EST/Unigene TCSA12569 |
| Acc. | TCSA12569 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Auxin-responsive protein IAA17 OS=Arabidopsis thaliana E-value=7e-53; Auxin-responsive protein IAA16 OS=Arabidopsis thaliana E-value=3e-50; Auxin-responsive protein IAA7 OS=Arabidopsis thaliana E-value=3e-49; Auxin-responsive protein IAA14 OS=Arabidopsis thaliana E-value=4e-49; Auxin-responsive protein IAA1 OS=Oryza sativa subsp. japonica E-value=9e-48; |
| Length | 998 nt |
| Species | Solanum arcanum |
| Belonged EST Libraries | SRR027943 (32 ESTs); |
| Sequence | TAGAGACCGAGGCGGCCGACATGTTTTGTTTTTTTTTCTTTTTTTTTCCCCAAGTGGCTT |
| EST members of Unigene | SRR027943.118171 SRR027943.319535 SRR027943.213089 SRR027943.10220 SRR027943.179648 SRR027943.143037 SRR027943.295615 SRR027943.141141 SRR027943.211559 SRR027943.255856 SRR027943.61446 SRR027943.38443 SRR027943.250724 SRR027943.390457 SRR027943.71710 SRR027943.409368 SRR027943.202100 SRR027943.140018 SRR027943.103554 SRR027943.486108 SRR027943.493992 SRR027943.394616 SRR027943.63884 SRR027943.339716 SRR027943.102416 SRR027943.216735 SRR027943.195474 SRR027943.269577 SRR027943.445909 SRR027943.210302 SRR027943.316739 SRR027943.14122 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | ARF |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839568 |
| Trichome-related Gene from Literature | 839568 |