Detail of EST/Unigene TCSA12634 |
Acc. | TCSA12634 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Probable aquaporin PIP2-1 OS=Oryza sativa subsp. japonica E-value=0; Aquaporin PIP2-2 OS=Zea mays E-value=0; Aquaporin PIP2-1 OS=Zea mays E-value=0; Aquaporin PIP2-2 OS=Arabidopsis thaliana E-value=0; Aquaporin PIP2-3 OS=Arabidopsis thaliana E-value=0; |
Length | 957 nt |
Species | Solanum arcanum |
Belonged EST Libraries | SRR027943 (24 ESTs); |
Sequence | TAGAGACCGAGGCGGCCGACATGTTTTGTTTTTTTTTCTTTCTTTTTTTATTAATTGGAT |
EST members of Unigene | SRR027943.75226 SRR027943.239486 SRR027943.129375 SRR027943.327229 SRR027943.283061 SRR027943.190456 SRR027943.371807 SRR027943.174813 SRR027943.372400 SRR027943.212942 SRR027943.202378 SRR027943.138743 SRR027943.401150 SRR027943.160170 SRR027943.345568 SRR027943.67017 SRR027943.473014 SRR027943.216528 SRR027943.373861 SRR027943.321833 SRR027943.255580 SRR027943.131651 SRR027943.336997 SRR027943.254798 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | 1.A.8 Major intrinsic protein MIP |
Probeset |
|
Corresponding NCBI Gene | 818293 |
Trichome-related Gene from Literature | 818293 |