| Detail of EST/Unigene TCSA12854 |
| Acc. | TCSA12854 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Gamma-glutamyltranspeptidase 1 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=7e-30; Gamma-glutamyltranspeptidase 1 OS=Mus musculus E-value=5e-28; Gamma-glutamyltranspeptidase 1 OS=Homo sapiens E-value=6e-28; Gamma-glutamyltransferase light chain 1 OS=Homo sapiens E-value=1e-27; Gamma-glutamyltranspeptidase 1 OS=Rattus norvegicus E-value=9e-27; |
| Length | 838 nt |
| Species | Solanum arcanum |
| Belonged EST Libraries | SRR027943 (16 ESTs); |
| Sequence | CTAAGAGATCACGGAACGAGTCACTTTTGCATTGTGGATTCAGATCGAAATGCTGTATCA |
| EST members of Unigene | SRR027943.389419 SRR027943.423870 SRR027943.317394 SRR027943.272400 SRR027943.341191 SRR027943.114497 SRR027943.104322 SRR027943.171453 SRR027943.236292 SRR027943.383230 SRR027943.440390 SRR027943.494583 SRR027943.402072 SRR027943.324392 SRR027943.133788 SRR027943.51909 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K00681 gamma-glutamyltranspeptidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K00681 gamma-glutamyltranspeptidase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00681 gamma-glutamyltranspeptidase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K00681 gamma-glutamyltranspeptidase; Metabolism > Metabolism of Other Amino Acids > ko00430 Taurine and hypotaurine metabolism > K00681 gamma-glutamyltranspeptidase |
| EC | 2.3.2.2 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 829042 |
| Trichome-related Gene from Literature | 829042 |