| Detail of EST/Unigene TCSA13317 |
| Acc. | TCSA13317 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 60S ribosomal protein L3 OS=Oryza sativa subsp. japonica E-value=2e-81; 60S ribosomal protein L3-2 OS=Arabidopsis thaliana E-value=6e-80; 60S ribosomal protein L3-1 OS=Arabidopsis thaliana E-value=3e-77; 60S ribosomal protein L3 OS=Drosophila melanogaster E-value=1e-59; 60S ribosomal protein L3 OS=Toxocara canis E-value=2e-59; |
| Length | 674 nt |
| Species | Solanum arcanum |
| Belonged EST Libraries | SRR027943 (23 ESTs); |
| Sequence | TAGAGACCGAGGCGGCCGACATGTTTTGTTTTTTTTTCTTTTTTTTTTCGTCCAAAAAAC |
| EST members of Unigene | SRR027943.463124 SRR027943.395250 SRR027943.92242 SRR027943.405090 SRR027943.436778 SRR027943.347258 SRR027943.445596 SRR027943.389493 SRR027943.134902 SRR027943.336528 SRR027943.471703 SRR027943.432423 SRR027943.201890 SRR027943.154699 SRR027943.160772 SRR027943.95529 SRR027943.397553 SRR027943.60741 SRR027943.257717 SRR027943.493620 SRR027943.287676 SRR027943.469535 SRR027943.1061 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Translation > ko03010 Ribosome > K02925 large subunit ribosomal protein L3e |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 842454 |
| Trichome-related Gene from Literature | 842454 |