| Detail of EST/Unigene TCSA13514 |
| Acc. | TCSA13514 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Protein WAX2 OS=Arabidopsis thaliana E-value=1e-72; |
| Length | 628 nt |
| Species | Solanum arcanum |
| Belonged EST Libraries | SRR027943 (21 ESTs); |
| Sequence | CTTTGTCACCTGAACTAAATATTTTTGATATTCAACAGGAGCTTCCTTTTGAATTTTTTG |
| EST members of Unigene | SRR027943.29568 SRR027943.476066 SRR027943.249528 SRR027943.157181 SRR027943.65195 SRR027943.393389 SRR027943.427631 SRR027943.245013 SRR027943.79786 SRR027943.256417 SRR027943.388053 SRR027943.358045 SRR027943.138057 SRR027943.362243 SRR027943.415742 SRR027943.424351 SRR027943.141611 SRR027943.4027 SRR027943.487117 SRR027943.458796 SRR027943.341879 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 835889 |
| Trichome-related Gene from Literature | 835889 |