| Detail of EST/Unigene TCSA13645 |
| Acc. | TCSA13645 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=2e-91; Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=1e-89; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=9e-88; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=3e-87; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=2e-86; |
| Length | 598 nt |
| Species | Solanum arcanum |
| Belonged EST Libraries | SRR027943 (26 ESTs); |
| Sequence | AATACGGTAACCCTCAACAGCTCCCATCAGTACAACTTGACAAGCCCAGATGGCCAAGAT |
| EST members of Unigene | SRR027943.210970 SRR027943.187128 SRR027943.379053 SRR027943.74218 SRR027943.130331 SRR027943.132501 SRR027943.161091 SRR027943.384365 SRR027943.41594 SRR027943.92326 SRR027943.166427 SRR027943.178568 SRR027943.138735 SRR027943.472690 SRR027943.484158 SRR027943.222753 SRR027943.466194 SRR027943.100037 SRR027943.341657 SRR027943.358161 SRR027943.191923 SRR027943.133590 SRR027943.388574 SRR027943.321244 SRR027943.44464 SRR027943.446906 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839871 |
| Trichome-related Gene from Literature | 839871 |