| Detail of EST/Unigene TCSA13845 |
| Acc. | TCSA13845 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 40S ribosomal protein S13 OS=Glycine max E-value=8e-79; 40S ribosomal protein S13-2 OS=Arabidopsis thaliana E-value=3e-76; 40S ribosomal protein S13-1 OS=Arabidopsis thaliana E-value=5e-76; 40S ribosomal protein S13 OS=Pisum sativum E-value=2e-75; 40S ribosomal protein S13-2 OS=Oryza sativa subsp. japonica E-value=6e-71; |
| Length | 558 nt |
| Species | Solanum arcanum |
| Belonged EST Libraries | SRR027943 (46 ESTs); |
| Sequence | CTACTCCAGCTCACGTCTCAGCCTATGCCACAAGTGTGCTAGCAGTGGTAGATTCGTATT |
| EST members of Unigene | SRR027943.378277 SRR027943.479193 SRR027943.131915 SRR027943.95443 SRR027943.208412 SRR027943.428958 SRR027943.302278 SRR027943.196102 SRR027943.135624 SRR027943.11827 SRR027943.340206 SRR027943.214496 SRR027943.288019 SRR027943.230921 SRR027943.286241 SRR027943.119212 SRR027943.285060 SRR027943.65400 SRR027943.46710 SRR027943.364167 SRR027943.87992 SRR027943.105852 SRR027943.76966 SRR027943.312854 SRR027943.306133 SRR027943.246453 SRR027943.460943 SRR027943.3819 SRR027943.143766 SRR027943.166277 SRR027943.393440 SRR027943.389130 SRR027943.387751 SRR027943.172131 SRR027943.406009 SRR027943.295149 SRR027943.157721 SRR027943.275113 SRR027943.178869 SRR027943.56662 SRR027943.163583 SRR027943.456089 SRR027943.247880 SRR027943.457638 SRR027943.324795 SRR027943.22412 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Translation > ko03010 Ribosome > K02953 small subunit ribosomal protein S13e |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 828167 |
| Trichome-related Gene from Literature | 828167 |