| Detail of EST/Unigene TCSA15391 |
| Acc. | TCSA15391 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Heat shock cognate 70 kDa protein 2 OS=Solanum lycopersicum E-value=3e-46; Probable mediator of RNA polymerase II transcription subunit 37e OS=Arabidopsis thaliana E-value=1e-45; Probable mediator of RNA polymerase II transcription subunit 37c OS=Arabidopsis thaliana E-value=1e-45; Chloroplast envelope membrane 70 kDa heat shock-related protein OS=Spinacia oleracea E-value=1e-45; Heat shock cognate 70 kDa protein OS=Petunia hybrida E-value=6e-45; |
| Length | 355 nt |
| Species | Solanum arcanum |
| Belonged EST Libraries | SRR027943 (12 ESTs); |
| Sequence | CGTGTTTCTGGGAATCAACACAGTCATGACACCACCAGCTGTCTCCAGACCAAGGGAAAG |
| EST members of Unigene | SRR027943.373184 SRR027943.187931 SRR027943.493352 SRR027943.170746 SRR027943.170946 SRR027943.319909 SRR027943.413665 SRR027943.436155 SRR027943.184710 SRR027943.450183 SRR027943.426310 SRR027943.71550 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K03283 heat shock 70kDa protein 1/8 |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | 1.A.3 Ryanodine-inositol-1,4,5-trisphosphate receptor Ca2+ channel RIR-CaC; 1.A.33 Cation-channel-forming heat-shock protein 70 Hsp70 |
| Probeset |
|
| Corresponding NCBI Gene | 831020 |
| Trichome-related Gene from Literature | 831020 |