Detail of EST/Unigene TCSA15577 |
Acc. | TCSA15577 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Phosphoprotein ECPP44 OS=Daucus carota E-value=2e-14; Dehydrin ERD10 OS=Arabidopsis thaliana E-value=7e-10; Dehydrin ERD14 OS=Arabidopsis thaliana E-value=6e-09; Dehydrin COR47 OS=Arabidopsis thaliana E-value=6e-09; Dehydrin COR410 OS=Triticum aestivum E-value=1e-08; |
Length | 334 nt |
Species | Solanum arcanum |
Belonged EST Libraries | SRR027943 (25 ESTs); |
Sequence | TAGAGACCGAGGCGGCCGACATGTTTTGTTTTTTTTCTTTTTTTTCTCTTCAGCCTTTGA |
EST members of Unigene | SRR027943.64363 SRR027943.257814 SRR027943.76800 SRR027943.288774 SRR027943.451290 SRR027943.303689 SRR027943.41406 SRR027943.311936 SRR027943.249354 SRR027943.120190 SRR027943.270087 SRR027943.13401 SRR027943.366060 SRR027943.35012 SRR027943.92362 SRR027943.13882 SRR027943.84339 SRR027943.288836 SRR027943.163730 SRR027943.250211 SRR027943.205389 SRR027943.298680 SRR027943.289275 SRR027943.91045 SRR027943.381733 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 838633 |
Trichome-related Gene from Literature | 838633 |