| Detail of EST/Unigene TCSA15642 |
| Acc. | TCSA15642 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Hexokinase-1 OS=Nicotiana tabacum E-value=5e-53; Hexokinase-2 OS=Solanum tuberosum E-value=2e-51; Hexokinase-1 OS=Solanum tuberosum E-value=3e-42; Hexokinase-1 OS=Spinacia oleracea E-value=9e-42; Hexokinase-1 OS=Arabidopsis thaliana E-value=3e-40; |
| Length | 326 nt |
| Species | Solanum arcanum |
| Belonged EST Libraries | SRR027943 (6 ESTs); |
| Sequence | CCGCAATATAATCAAAAAGTTCATCTGAAGTCCCAACCATCAAACTTGGAGGAATTGATG |
| EST members of Unigene | SRR027943.57726 SRR027943.374748 SRR027943.394280 SRR027943.160605 SRR027943.126140 SRR027943.107851 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00521 Streptomycin biosynthesis > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00530 Aminosugars metabolism > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00051 Fructose and mannose metabolism > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K00844 hexokinase |
| EC | 2.7.1.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 829034 |
| Trichome-related Gene from Literature | 829034 |