| Detail of EST/Unigene TCSA16061 |
| Acc. | TCSA16061 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | V-type proton ATPase subunit C OS=Arabidopsis thaliana E-value=5e-20; V-type proton ATPase subunit C OS=Hordeum vulgare E-value=9e-17; |
| Length | 289 nt |
| Species | Solanum arcanum |
| Belonged EST Libraries | SRR027943 (10 ESTs); |
| Sequence | GGACTCGTATTTCTATCTTCCTTTGCATCTAATCAATCAAACCAAGAAGAAAGAACAAGT |
| EST members of Unigene | SRR027943.162674 SRR027943.339030 SRR027943.345506 SRR027943.327037 SRR027943.449689 SRR027943.87574 SRR027943.397807 SRR027943.80474 SRR027943.49161 SRR027943.383079 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | 3.A.2 H+- or Na+-translocating F-type, V-type and A-type ATPase superfamily F-ATPase |
| Probeset |
|
| Corresponding NCBI Gene | 837840 |
| Trichome-related Gene from Literature | 837840 |