Detail of EST/Unigene TCSA16061 |
Acc. | TCSA16061 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | V-type proton ATPase subunit C OS=Arabidopsis thaliana E-value=5e-20; V-type proton ATPase subunit C OS=Hordeum vulgare E-value=9e-17; |
Length | 289 nt |
Species | Solanum arcanum |
Belonged EST Libraries | SRR027943 (10 ESTs); |
Sequence | GGACTCGTATTTCTATCTTCCTTTGCATCTAATCAATCAAACCAAGAAGAAAGAACAAGT |
EST members of Unigene | SRR027943.162674 SRR027943.339030 SRR027943.345506 SRR027943.327037 SRR027943.449689 SRR027943.87574 SRR027943.397807 SRR027943.80474 SRR027943.49161 SRR027943.383079 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | 3.A.2 H+- or Na+-translocating F-type, V-type and A-type ATPase superfamily F-ATPase |
Probeset |
|
Corresponding NCBI Gene | 837840 |
Trichome-related Gene from Literature | 837840 |