| Detail of EST/Unigene TCSA16134 |
| Acc. | TCSA16134 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Serine hydroxymethyltransferase, mitochondrial OS=Pisum sativum E-value=2e-15; Serine hydroxymethyltransferase, mitochondrial OS=Arabidopsis thaliana E-value=1e-11; Serine hydroxymethyltransferase, mitochondrial OS=Solanum tuberosum E-value=6e-11; Serine hydroxymethyltransferase 1, mitochondrial OS=Flaveria pringlei E-value=1e-10; Serine hydroxymethyltransferase 2, mitochondrial OS=Flaveria pringlei E-value=9e-10; |
| Length | 278 nt |
| Species | Solanum arcanum |
| Belonged EST Libraries | SRR027943 (6 ESTs); |
| Sequence | CAATCTCTGGATCAATTTCTTCAAGTGGCGCATTCAACTGCTTAATCCACGTAACTCGCG |
| EST members of Unigene | SRR027943.357515 SRR027943.119387 SRR027943.319183 SRR027943.95568 SRR027943.74547 SRR027943.286291 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 829949 |
| Trichome-related Gene from Literature | 829949 |