Detail of EST/Unigene TCSH51255 |
Acc. | TCSH51255 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Proteasome subunit alpha type-5 OS=Glycine max E-value=0; Proteasome subunit alpha type-5 OS=Oryza sativa subsp. japonica E-value=0; Proteasome subunit alpha type-5-B OS=Arabidopsis thaliana E-value=0; Proteasome subunit alpha type-5-A OS=Arabidopsis thaliana E-value=0; Proteasome subunit alpha type-5 OS=Mus musculus E-value=1e-67; |
Length | 830 nt |
Species | Solanum habrochaites |
Belonged EST Libraries | SRR027941 (6 ESTs); SRR027940 (2 ESTs); LIBEST_025264 (1 ESTs); |
Sequence | AATTGGATTGAAGACTAAGGAAGGAGTTGTTCTTGCTGTGGAGAAGCGCATTACTTCACC |
EST members of Unigene | SRR027941.184695 SRR027940.57103 SRR027941.133225 SRR027940.109831 SRR027941.75414 SRR027940.78753 SRR027940.16359 SRR027940.93851 SRR027941.314739 SRR027941.217971 SRR027940.9630 SRR027940.56971 SRR027940.64629 SRR027940.97848 SRR027940.11109 SRR027940.105689 SRR027941.282902 SRR027941.152606 SRR027940.107061 SRR027941.15763 SRR027940.125036 SRR027941.194894 SRR027940.33893 SRR027940.15930 SRR027941.145752 SRR027941.277271 GT160804 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Folding, Sorting and Degradation > ko03050 Proteasome > K02729 20S proteasome subunit alpha 5 |
EC | 3.4.25.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820649 |
Trichome-related Gene from Literature | 820649 |