| Detail of EST/Unigene TCSH51845 |
| Acc. | TCSH51845 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 3-ketoacyl-CoA thiolase 2, peroxisomal OS=Arabidopsis thaliana E-value=0; 3-ketoacyl-CoA thiolase 1, peroxisomal OS=Arabidopsis thaliana E-value=0; 3-ketoacyl-CoA thiolase 5, peroxisomal OS=Arabidopsis thaliana E-value=0; 3-ketoacyl-CoA thiolase A, peroxisomal OS=Mus musculus E-value=0; 3-ketoacyl-CoA thiolase B, peroxisomal OS=Rattus norvegicus E-value=0; |
| Length | 1308 nt |
| Species | Solanum habrochaites |
| Belonged EST Libraries | SRR027941 (35 ESTs); SRR027940 (22 ESTs); LIBEST_025265 (1 ESTs); LIBEST_025268 (1 ESTs); |
| Sequence | TTTGTTGCATAAGGAAGCTGTTTTTTATTATCATCTTAAAACCAAATAAAAGGAACACAA |
| EST members of Unigene | SRR027941.152677 SRR027941.264519 SRR027940.665 SRR027941.59236 SRR027940.79298 SRR027940.40068 SRR027940.105747 SRR027941.166482 SRR027941.305706 SRR027941.200555 SRR027941.107419 SRR027940.9341 SRR027941.72743 SRR027940.82799 SRR027940.89759 SRR027941.33303 SRR027941.190182 SRR027940.64701 SRR027941.260746 SRR027941.116249 SRR027940.3806 SRR027941.267998 SRR027941.138922 SRR027940.5731 SRR027941.273282 SRR027941.233863 SRR027940.59617 SRR027941.72594 SRR027940.83255 SRR027940.86228 SRR027941.51858 SRR027941.171909 SRR027940.120735 SRR027941.178139 SRR027941.297144 SRR027941.162726 SRR027941.96372 SRR027940.63752 SRR027941.246656 SRR027941.171897 SRR027941.150938 GT162478 SRR027940.63556 GT182315 SRR027941.174726 SRR027941.43242 SRR027940.10111 SRR027940.74249 SRR027941.150600 SRR027940.98970 SRR027940.30581 SRR027941.46697 SRR027941.327070 SRR027941.4502 SRR027940.18977 SRR027941.132946 SRR027941.160942 SRR027941.64421 SRR027940.74215 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00362 Benzoate degradation via hydroxylation > K07513 acetyl-CoA acyltransferase 1; Metabolism > Lipid Metabolism > ko00120 Bile acid biosynthesis > K07513 acetyl-CoA acyltransferase 1; Metabolism > Lipid Metabolism > ko01040 Biosynthesis of unsaturated fatty acids > K07513 acetyl-CoA acyltransferase 1; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K07513 acetyl-CoA acyltransferase 1; Metabolism > Amino Acid Metabolism > ko00280 Valine, leucine and isoleucine degradation > K07513 acetyl-CoA acyltransferase 1 |
| EC | 2.3.1.16 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 817876 |
| Trichome-related Gene from Literature | 817876 |