Detail of EST/Unigene TCSL70161 |
Acc. | TCSL70161 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Protein HOTHEAD OS=Arabidopsis thaliana E-value=0; (R)-mandelonitrile lyase-like OS=Arabidopsis thaliana E-value=0; (R)-mandelonitrile lyase 1 OS=Prunus serotina E-value=0; (R)-mandelonitrile lyase 3 OS=Prunus serotina E-value=2e-99; (R)-mandelonitrile lyase 2 OS=Prunus serotina E-value=8e-99; |
Length | 2036 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SRR015436 (71 ESTs); SL_flower_buds3 (5 ESTs); SL_FLOWERBUDS3 (4 ESTs); SL_maturing_fruit (3 ESTs); SL_SHOOT_8WEEK (3 ESTs); SL_SHOOT_4WEEK (3 ESTs); SRR015435 (3 ESTs); SL_flower_buds8 (2 ESTs); SL_MicroLEAF3 (2 ESTs); SL_FLOWER_DEV (2 ESTs); SL_Lyc_leaf (2 ESTs); SL_flowerbuds4 (2 ESTs); SL_FLOWER (1 ESTs); LIBEST_024426 (1 ESTs); |
Sequence | TCTCTCTGTGATTTTCAACCTTCTTCTCTCTTTACTTGTATGCCATCTCCATTTCACCAT |
EST members of Unigene | SRR015436.167524 SRR015436.247285 SRR015436.275701 SRR015436.129185 SRR015436.319756 BG124045 SRR015436.85438 SRR015436.150161 SRR015436.127938 BG643247 SRR015436.66344 SRR015435.171011 SRR015436.311585 SRR015436.132086 SRR015436.246157 SRR015436.142542 SRR015436.155216 SRR015436.220029 SRR015436.139263 SRR015436.282938 SRR015436.261678 AW929556 SRR015436.328046 SRR015436.109570 BP879475 SRR015436.154450 BG630015 AW945022 SRR015436.216803 AW945016 SRR015436.273195 DB686538 DB698288 BI926641 BG631719 SRR015436.285967 SRR015436.157913 SRR015436.307972 SRR015436.234943 SRR015436.147151 SRR015436.149569 BI926283 SRR015436.328488 SRR015436.215916 SRR015436.120010 BP900294 SRR015436.163776 SRR015436.180775 AI491026 BI926268 SRR015436.153062 BP896020 SRR015436.36500 BE354607 SRR015436.158354 AW934709 SRR015436.211764 SRR015436.113537 SRR015436.246499 SRR015436.202892 SRR015436.327136 SRR015436.19446 BP888446 BI930364 SRR015436.171919 SRR015436.274719 SRR015436.235414 SRR015435.236634 SRR015436.293811 SRR015436.303630 SRR015436.175611 SRR015436.3632 BI926810 SRR015436.267400 SRR015436.120703 SRR015436.249593 BG643560 SRR015436.163439 SRR015436.231988 SRR015436.161237 BE353553 AI490928 SRR015436.212933 BE354739 SRR015436.325381 SRR015436.100988 SRR015436.104215 SRR015436.289034 SRR015436.112122 SRR015436.84316 BP886674 SRR015436.252251 AW928856 FS181977 SRR015436.23463 SRR015436.320479 SRR015436.207562 SRR015436.326340 SRR015436.308438 SRR015436.92749 BI924446 SRR015436.267674 SRR015435.331079 AI490938 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00260 Glycine, serine and threonine metabolism > K00108 choline dehydrogenase |
EC | 1.1.-.- 1.1.99.1 1.1.99.10 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 843628 |
Trichome-related Gene from Literature | 843628 |