Detail of EST/Unigene TCSL72315 |
Acc. | TCSL72315 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Pre-mRNA-splicing factor SF2 OS=Arabidopsis thaliana E-value=7e-70; Probable splicing factor, arginine/serine-rich 3 OS=Caenorhabditis elegans E-value=9e-43; Serine/arginine-rich splicing factor 1B OS=Danio rerio E-value=2e-42; Serine/arginine-rich splicing factor 1 OS=Gallus gallus E-value=3e-42; Serine/arginine-rich splicing factor 1 OS=Pongo abelii E-value=9e-41; |
Length | 1245 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SRR015435 (17 ESTs); SL_maturing_fruit (4 ESTs); SL_Lyc_leaf (3 ESTs); SL_GFRUIT (3 ESTs); SL_FRUIT (2 ESTs); SL_SHOOT_8WEEK (2 ESTs); SL_CROWNGALL (2 ESTs); SL_flower_buds3 (2 ESTs); SL_MicroLEAF3 (1 ESTs); SL_CELL_BTI (1 ESTs); SL_flowerbuds4 (1 ESTs); SL_ROOT (1 ESTs); SL_PRERIP_FRUIT_TAMU (1 ESTs); SL_SUS_LEAF (1 ESTs); SL_radicle (1 ESTs); SL_SHOOT_4WEEK (1 ESTs); |
Sequence | AATCTTCAAAATTTCCTCTTCTTCTACGCTTTCTGCTCTCGATCTTCCCAGGAACAATGA |
EST members of Unigene | BP882571 BE462753 SRR015436.153610 SRR015435.214418 BG735005 AW933510 SRR015435.122148 SRR015436.117614 BE459773 BG124656 BM411303 DB695853 AW094132 AW626071 SRR015435.316568 SRR015435.27546 SRR015435.5769 SRR015435.148714 SRR015435.4459 BI925099 BG135640 SRR015435.205145 BE434660 AI486620 BG134302 SRR015435.50121 BE435713 BG628849 SRR015435.87717 BP888134 BI933551 BI206962 SRR015435.300382 SRR015436.2090 SRR015435.5048 SRR015435.199564 SRR015436.197329 SRR015436.168299 BI924289 BI206495 AI781942 BE459465 BP896765 BE434428 SRR015435.144521 BP900449 SRR015435.52481 BT012710 BE461410 AI490763 SRR015435.207346 AI490754 SRR015435.36626 BG644085 BP879141 SRR015435.283403 SRR015435.69416 AI486527 BP881849 AW219551 BF051986 BI209171 BP899242 SRR015435.151928 SRR015436.127218 SRR015435.194534 BG125084 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839262 |
Trichome-related Gene from Literature | 839262 |