| Detail of EST/Unigene TCSL72454 |
| Acc. | TCSL72454 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=0; Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 91R, chloroplastic OS=Petunia sp. E-value=0; |
| Length | 950 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SL_Lyc_leaf (1 ESTs); |
| Sequence | CAACTTCAACAATATCTCATACCATCAAACACTTACATTTCTCTTGATATAAACACCATG |
| EST members of Unigene | BP903804 BP898781 GH622818 AI772487 BG128679 BP904185 BP896068 BP899542 CK714976 AI772854 BP910187 AI777644 AI482855 CK715022 BG125237 BP896682 BP896100 BP898804 BG125423 BG629470 AW039748 AI482857 BP903043 BP898766 BP900503 BP897005 AI780432 AI780431 AI780430 BP908591 BP901058 AW038305 BG124385 AW037912 BP898533 BG126910 AI774275 AW091924 AW096557 BP896827 BP898757 BP898563 AI772067 AW041843 BP901653 BP903582 BG124018 SRR015436.4973 AW443877 BP909132 AI772787 AI779026 AI775104 AW039642 BP900816 BP906796 SRR015435.189643 BP904276 AI774695 AW093631 BP900830 BP897367 AW092155 BP897945 AI777486 BP897943 BP898522 BP900453 BG123788 BP899097 BP900060 BP900793 AI776583 BP901161 BP907533 AI778781 AI778780 BP899221 BP896516 BP897480 AW443008 AI772326 BP910409 AW040382 BP909470 AI782305 BP897121 AI777152 AW094562 AW443032 BP905423 BP897501 BP901558 AI774679 BP911211 AW094356 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839871 |
| Trichome-related Gene from Literature | 839871 |