Detail of EST/Unigene TCSL73794 |
Acc. | TCSL73794 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Protein WAX2 OS=Arabidopsis thaliana E-value=0; |
Length | 2246 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SRR015435 (47 ESTs); SRR015436 (17 ESTs); SL_TAMU_CALLUS (10 ESTs); SL_SHOOT_4WEEK (4 ESTs); SL_flower_buds4 (4 ESTs); SL_RES (4 ESTs); SL_CELL_BTI (4 ESTs); SL_germ_seedlings_TAMU (3 ESTs); SL_FLOWER_DEV (3 ESTs); SL_flowerbuds4 (3 ESTs); SL_MicroLEAF3 (2 ESTs); SL_flower_anthesis (2 ESTs); SL_breaker_fruit (2 ESTs); SL_FRUIT (2 ESTs); SL_CALLUS (2 ESTs); SL_FLOWER (2 ESTs); SL_flower_buds3 (2 ESTs); SL_FLOWERBUDS (2 ESTs); SL_MicroFRUIT (1 ESTs); SL_FLOWERBUDS3 (1 ESTs); SL_SHOOT_8WEEK (1 ESTs); SL_PRERIP_FRUIT_TAMU (1 ESTs); SL_CROWNGALL (1 ESTs); SL_SUS_LEAF (1 ESTs); |
Sequence | GTCCATCTTACTAAGGAAGTAAGTAAAAGGGAGAGCGCATTAATGACAATATTTACTCTG |
EST members of Unigene | AW034520 BE462350 SRR015435.313507 AW034523 SRR015435.220649 SRR015436.329476 SRR015435.359681 SRR015436.121862 BG629066 SRR015436.281493 SRR015435.37263 SRR015435.160533 SRR015436.336439 AW034318 BE354704 AI896430 BI922069 DB712191 SRR015436.302285 AW093932 BG128712 SRR015435.120600 AI896039 AW429169 AI775598 AI896434 BG631597 BG627347 SRR015436.95420 SRR015435.36059 BE433524 AW650033 AI482608 AW930853 DB697981 BM536006 SRR015435.47216 SRR015435.55756 SRR015435.72435 BI928351 AW033107 BI935252 BI929505 SRR015435.84840 SRR015435.228847 SRR015435.280789 AW650283 BE433908 AI774401 SRR015435.314888 SRR015436.204131 AW615936 SRR015435.257147 BM412792 SRR015435.148929 BI926861 SRR015435.282910 AW030407 BI921615 BG127469 SRR015435.266190 SRR015435.314153 SRR015435.356268 BI924858 BG133468 SRR015435.260516 SRR015435.314969 BI927332 SRR015436.247854 SRR015435.323877 SRR015435.265946 SRR015435.190430 BI931128 BG127804 AW443249 SRR015435.185943 SRR015435.306625 BG127078 SRR015436.128620 SRR015435.227709 SRR015435.300006 SRR015436.114759 SRR015435.273663 AW737630 SRR015436.205084 SRR015435.299628 SRR015435.117031 AW648705 BI934059 AI782721 AW030126 DB700070 SRR015435.158721 AW037244 SRR015435.160275 SRR015435.162024 SRR015435.8642 AW031181 AI484220 SRR015436.320929 AI484218 SRR015435.312303 AW737555 SRR015436.162073 BI927475 AW037246 SRR015436.138798 SRR015435.331841 SRR015435.84900 SRR015435.112596 SRR015435.267698 SRR015435.330293 SRR015436.10953 SRR015435.7061 SRR015435.301996 SRR015436.94052 SRR015436.203815 SRR015435.25535 BI932845 SRR015435.72702 SRR015435.172693 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 837602 |
Trichome-related Gene from Literature | 837602 |