| Detail of EST/Unigene TCSL73814 |
| Acc. | TCSL73814 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | WD-40 repeat-containing protein MSI4 OS=Arabidopsis thaliana E-value=0; WD-40 repeat-containing protein MSI5 OS=Arabidopsis thaliana E-value=0; WD-40 repeat-containing protein MSI1 OS=Arabidopsis thaliana E-value=5e-54; Probable histone-binding protein rbbD OS=Dictyostelium discoideum E-value=2e-53; Histone-binding protein RBBP4 OS=Mus musculus E-value=3e-53; |
| Length | 2186 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015436 (13 ESTs); SRR015435 (6 ESTs); SL_maturing_fruit (4 ESTs); LIBEST_024426 (4 ESTs); SL_SHOOT_4WEEK (3 ESTs); SL_MicroLEAF3 (3 ESTs); SL_Lyc_leaf (2 ESTs); SL_TAMU (2 ESTs); SL_flower_anthesis (2 ESTs); SL_TAMU_CALLUS (1 ESTs); SL_flower_buds3 (1 ESTs); SL_MicroFRUIT2 (1 ESTs); LIBEST_024457 (1 ESTs); SL_FLOWER_DEV (1 ESTs); LIBEST_024458 (1 ESTs); SL_MicroFRUIT (1 ESTs); SL_FLOWER (1 ESTs); SL_breaker_fruit (1 ESTs); SL_CROWNGALL (1 ESTs); SL_flowerbuds4 (1 ESTs); |
| Sequence | GAAGACGTTTGACCATGATTCAATTTTACTTTTTTTTCTTGAAATTTCAGAAATTCAACT |
| EST members of Unigene | FS194371 GO376345 SRR015436.236054 AI483709 BM412411 BP900693 SRR015435.162680 BP878685 SRR015436.69016 DB689642 BP901685 SRR015436.251267 SRR015435.46231 BI924516 GO375296 SRR015436.235401 SRR015436.217898 SRR015435.123577 SRR015436.293576 FS183454 SRR015435.213691 BG129226 FS201161 BW687270 BP887776 SRR015436.136477 AW032846 AI487916 SRR015436.318433 FS192387 BG128792 BP878611 DB680652 SRR015436.80928 DB694840 BG134460 SRR015436.104600 SRR015436.284592 BG126033 SRR015436.91947 SRR015435.101624 BI423407 BI931838 SRR015436.322369 BP882976 SRR015435.233231 BI934374 DB725243 BI934386 BG628927 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | 3.A.2 H+- or Na+-translocating F-type, V-type and A-type ATPase superfamily F-ATPase |
| Probeset |
|
| Corresponding NCBI Gene | 816471 |
| Trichome-related Gene from Literature | 816471 |