| Detail of EST/Unigene TCSL73980 |
| Acc. | TCSL73980 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Polyubiquitin-A OS=Caenorhabditis elegans E-value=0; Polyubiquitin-C OS=Bos taurus E-value=0; Polyubiquitin OS=Drosophila melanogaster E-value=0; Polyubiquitin-C OS=Rattus norvegicus E-value=0; Polyubiquitin-C OS=Pongo pygmaeus E-value=0; |
| Length | 1955 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015436 (15 ESTs); SRR015435 (14 ESTs); SL_maturing_fruit (8 ESTs); SL_FSSH (6 ESTs); SL_MicroFRUIT2 (6 ESTs); SL_PRERIP_FRUIT_TAMU (4 ESTs); SL_TAMU (4 ESTs); SL_TAMU_CALLUS (3 ESTs); SL_FRUIT (3 ESTs); SL_GFRUIT (3 ESTs); SL_SHOOT_4WEEK (3 ESTs); SL_MicroFRUIT (2 ESTs); SL_CELL_BTI (2 ESTs); SL_FLOWERBUDS (2 ESTs); SL_FLOWER_DEV (1 ESTs); SL_breaker_fruit (1 ESTs); SL_RIP_FRUIT_TAMU (1 ESTs); SL_FLOWERBUDS3 (1 ESTs); SL_radicle (1 ESTs); SL_DROOT (1 ESTs); LIBEST_024458 (1 ESTs); SL_FLOWER (1 ESTs); SL_flower_buds4 (1 ESTs); SL_Lyc_leaf (1 ESTs); SL_RES (1 ESTs); SL_flower_anthesis (1 ESTs); |
| Sequence | GAGCCATAGGCCCATACGTTTCCTCTCTGTGGCGGCAAAGCGGTTACTATAAATACAGAT |
| EST members of Unigene | BW689299 AW932645 BP882168 SRR015436.334446 SRR015436.105102 BW688686 AW037748 SRR015436.30902 BE458748 SRR015436.115089 BI933964 AW930157 AW094135 BW692314 SRR015435.23820 BE460164 SRR015436.13244 BE353781 SRR015436.51080 BI422105 BP892189 SRR015436.200122 BG130389 EY506241 SRR015436.176253 AW930854 BW689249 BE436484 SRR015435.324794 BP883083 EG553797 BG128838 EY506242 EY506243 BP879242 SRR015435.266839 BE433497 EY506246 SRR015436.272526 EY506245 EY506244 SRR015436.79590 BI928153 AI772141 BW690022 SRR015435.148988 SRR015435.239566 BM412717 AW933918 DB725051 BP878220 SRR015436.260300 SRR015436.147418 BP890201 SRR015435.244598 SRR015435.23538 AI897030 SRR015435.154583 SRR015436.122989 SRR015435.291864 BG628616 BI931359 BE460068 AI484835 SRR015436.245639 BP895591 SRR015435.41441 GO376063 SRR015435.65934 SRR015435.47501 AW034185 DB709757 AI489637 BG128543 AI894707 AW928419 BE353822 SRR015435.257058 AI484800 BP895586 SRR015436.234118 SRR015435.237066 BW692157 BE434777 AW218270 AW442142 BP902712 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 825880 |
| Trichome-related Gene from Literature | 825880 |