| Detail of EST/Unigene TCSL74257 |
| Acc. | TCSL74257 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 1-aminocyclopropane-1-carboxylate synthase OS=Glycine max E-value=0; 1-aminocyclopropane-1-carboxylate synthase 2 OS=Solanum lycopersicum E-value=0; 1-aminocyclopropane-1-carboxylate synthase 1 OS=Prunus mume E-value=0; 1-aminocyclopropane-1-carboxylate synthase OS=Nicotiana tabacum E-value=0; 1-aminocyclopropane-1-carboxylate synthase 6 OS=Arabidopsis thaliana E-value=0; |
| Length | 1760 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SL_TAMU (16 ESTs); SL_CDS (4 ESTs); SL_TAMU_CALLUS (2 ESTs); SL_GFRUIT (1 ESTs); SL_CALLUS (1 ESTs); SL_SUS_LEAF (1 ESTs); |
| Sequence | CAAAATCTCTTTAATTTCTATAAAATATAAAATAAAAAAAGGTCTATATATTAGCAAATT |
| EST members of Unigene | AI486115 AW034048 BI921101 BE458995 AI490629 AI490418 LEACS6 AI899193 AI897818 AI484859 AI485635 AI898099 AF179249 AI897529 AW032684 AB013346 AB013100 AI489673 AI487909 AI484986 AI899645 AI488097 AI487898 AI489650 AI771539 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K00814 alanine transaminase; Metabolism > Amino Acid Metabolism > ko00252 Alanine and aspartate metabolism > K00814 alanine transaminase; Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K00814 alanine transaminase; Metabolism > Biosynthesis of Secondary Metabolites > ko00950 Alkaloid biosynthesis I > K00815 tyrosine aminotransferase; Metabolism > Biosynthesis of Secondary Metabolites > ko00401 Novobiocin biosynthesis > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00360 Phenylalanine metabolism > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00400 Phenylalanine, tyrosine and tryptophan biosynthesis > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K00815 tyrosine ami |
| EC | 2.6.1.2 2.6.1.5 4.4.1.14 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 826730 |
| Trichome-related Gene from Literature | 826730 |