Detail of EST/Unigene TCSL74367 |
Acc. | TCSL74367 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Hydroxymethylglutaryl-CoA synthase OS=Arabidopsis thaliana E-value=0; Hydroxymethylglutaryl-CoA synthase, cytoplasmic OS=Pongo abelii E-value=0; Hydroxymethylglutaryl-CoA synthase, cytoplasmic OS=Homo sapiens E-value=0; Hydroxymethylglutaryl-CoA synthase 1 OS=Blattella germanica E-value=0; Hydroxymethylglutaryl-CoA synthase, cytoplasmic OS=Mus musculus E-value=0; |
Length | 1693 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_TAMU (5 ESTs); SRR015435 (2 ESTs); SL_TAMU_CALLUS (2 ESTs); SL_germ_seedlings_TAMU (1 ESTs); SL_flowerbuds4 (1 ESTs); SL_flower_buds3 (1 ESTs); SL_CDS (1 ESTs); SRR015436 (1 ESTs); |
Sequence | GTGTGTGTTCGCCGGCGCTTAATTCGAGGAGATTTAGAGCGAGAGAAAACGTTGTGTTCG |
EST members of Unigene | AI487626 AI486047 AI485840 SRR015436.166497 AW650807 AI488358 AW035310 BI926159 AI489906 AI896918 AW615993 SRR015435.120934 SRR015435.278366 EU253956 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00650 Butanoate metabolism > K01641 hydroxymethylglutaryl-CoA synthase; Metabolism > Lipid Metabolism > ko00072 Synthesis and degradation of ketone bodies > K01641 hydroxymethylglutaryl-CoA synthase; Metabolism > Amino Acid Metabolism > ko00280 Valine, leucine and isoleucine degradation > K01641 hydroxymethylglutaryl-CoA synthase |
EC | 2.3.3.10 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 826788 |
Trichome-related Gene from Literature | 826788 |