Detail of EST/Unigene TCSL74591 |
Acc. | TCSL74591 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Phosphoenolpyruvate carboxylase 1 OS=Arabidopsis thaliana E-value=0; Phosphoenolpyruvate carboxylase OS=Picea abies E-value=0; Phosphoenolpyruvate carboxylase 3 OS=Arabidopsis thaliana E-value=0; Phosphoenolpyruvate carboxylase, housekeeping isozyme OS=Glycine max E-value=0; Phosphoenolpyruvate carboxylase 2 OS=Sorghum bicolor E-value=0; |
Length | 1591 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SRR015435 (11 ESTs); SL_Lyc_leaf (11 ESTs); SL_RIP_FRUIT_TAMU (3 ESTs); SL_SUS_LEAF (3 ESTs); SRR015436 (3 ESTs); SL_maturing_fruit (2 ESTs); SL_FLOWER_DEV (2 ESTs); SL_CELL_BTI (2 ESTs); SL_breaker_fruit (2 ESTs); SL_flower_buds3 (1 ESTs); SL_SHOOT_4WEEK (1 ESTs); LIBEST_024456 (1 ESTs); SL_TAMU_CALLUS (1 ESTs); |
Sequence | GAGACAGGACTGGCTCTTATCTGAACTAAGTGGCAAGCGTCCACTTTTTGGACCTGATCT |
EST members of Unigene | SRR015435.270094 BP908060 BP909800 AW223731 SRR015436.87817 AI779719 BG125242 BG626017 SRR015435.79709 AI780863 SRR015435.316037 SRR015435.352534 AW032344 BM410655 SRR015435.299391 SRR015436.101287 SRR015435.230774 SRR015436.238713 BP906489 AW222736 BG631620 SRR015435.304352 AW223174 SRR015435.127903 BM413099 BP906606 BP910478 SRR015435.318827 BP888667 BP910501 GO372583 AI779638 BP907749 AW096264 BP907130 BI924035 BP896700 BP887815 SRR015435.39930 SRR015435.264616 BP910439 AW037531 BP905811 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K01595 phosphoenolpyruvate carboxylase; Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K01595 phosphoenolpyruvate carboxylase; Metabolism > Energy Metabolism > ko00720 Reductive carboxylate cycle (CO2 fixation) > K01595 phosphoenolpyruvate carboxylase |
EC | 4.1.1.31 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 841765 |
Trichome-related Gene from Literature | 841765 |