Detail of EST/Unigene TCSL74600 |
Acc. | TCSL74600 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Mannose-1-phosphate guanylyltransferase 1 OS=Arabidopsis thaliana E-value=0; Probable mannose-1-phosphate guanylyltransferase 3 OS=Oryza sativa subsp. japonica E-value=0; Probable mannose-1-phosphate guanylyltransferase 1 OS=Oryza sativa subsp. japonica E-value=0; Probable mannose-1-phosphate guanylyltransferase 2 OS=Oryza sativa subsp. japonica E-value=0; Probable mannose-1-phosphate guanylyltransferase 2 OS=Arabidopsis thaliana E-value=0; |
Length | 1581 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_GFRUIT (18 ESTs); SRR015435 (14 ESTs); SL_maturing_fruit (9 ESTs); SL_Lyc_leaf (7 ESTs); SRR015436 (5 ESTs); SL_flower_buds4 (4 ESTs); SL_TAMU_CALLUS (4 ESTs); SL_PRERIP_FRUIT_TAMU (3 ESTs); SL_CDS (3 ESTs); LIBEST_024456 (2 ESTs); SL_MicroLEAF3 (2 ESTs); SL_FRUIT (2 ESTs); SL_flower_buds8 (1 ESTs); SL_germ_seedlings_TAMU (1 ESTs); SL_RES (1 ESTs); SL_flower_anthesis (1 ESTs); SL_FLOWER_DEV (1 ESTs); SL_breaker_fruit (1 ESTs); SL_cTOS (1 ESTs); SL_TAMU (1 ESTs); SL_CELL_BTI (1 ESTs); SL_FLOWERBUDS3 (1 ESTs); SL_SHOOT_4WEEK (1 ESTs); |
Sequence | GGCCATTACGGCCGGGGAACACCGATCGATCTTTTAACAAACTCCCTAAACACACTCACT |
EST members of Unigene | BF050498 BE460168 BE459820 GO373519 SRR015436.101675 BP879659 BE458951 BF050666 BE458657 BF050509 BP910970 BF051441 AI775612 BI927467 SRR015435.118463 BI928043 BP897069 BP892429 BF051834 BF051486 AW934433 BE458764 AW035813 DB705889 BT012749 SRR015435.290863 SRR015435.243394 BP882318 BP877491 SRR015435.18658 AW648084 BP896816 BP897011 BE458434 BE459933 BE458257 BP896642 BE434298 AW217167 BI929919 BP888511 BP894863 AW931615 GO372522 AI485396 SRR015435.282011 BE437015 AW623276 BP876662 DB705824 BE354586 SRR015435.99987 SRR015436.198212 BP905845 BG124475 BF050217 SRR015435.245365 SRR015435.291870 SRR015435.282570 BI933297 BG630344 BE459858 BP890171 BI929637 SRR015436.27060 SRR015435.27888 BE459989 AW443783 SRR015436.222243 BI421941 BF050517 SRR015435.114387 AW032229 SRR015435.323919 SRR015435.161057 BI207241 BP911416 SRR015436.148461 BP884753 SRR015435.320801 AW930943 BM535143 AY605668 DQ449030 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00051 Fructose and mannose metabolism > K00966 mannose-1-phosphate guanylyltransferase; Metabolism > Carbohydrate Metabolism > ko00051 Fructose and mannose metabolism > K00971 mannose-1-phosphate guanylyltransferase |
EC | 2.7.7.13 2.7.7.22 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818562 |
Trichome-related Gene from Literature | 818562 |