| Detail of EST/Unigene TCSL75076 |
| Acc. | TCSL75076 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | unknown |
| Length | 1417 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015435 (9 ESTs); SRR015436 (6 ESTs); SL_flower_buds3 (4 ESTs); SL_FLOWERBUDS (3 ESTs); SL_MicroLEAF3 (3 ESTs); SL_FLOWER_DEV (2 ESTs); SL_maturing_fruit (2 ESTs); SL_SHOOT_8WEEK (1 ESTs); SL_FLOWER (1 ESTs); SL_SUS_LEAF (1 ESTs); LIBEST_024457 (1 ESTs); SL_SHOOT_4WEEK (1 ESTs); SL_flowerbuds4 (1 ESTs); SL_FLOWERBUDS3 (1 ESTs); |
| Sequence | CTAACTCCTTTCTTTTGTCACTTCACTCTTAGTAGTTGTCTCTTTAATTTGGAAGCAAAC |
| EST members of Unigene | SRR015435.160337 GO374405 AW737908 AW738110 SRR015435.336561 AW738113 AW217296 BI923596 DB692096 SRR015435.128009 BG127887 AI491038 BI925112 SRR015435.100517 BI930801 SRR015436.211932 BI923746 SRR015436.125194 AW928583 SRR015435.285650 SRR015435.109269 SRR015435.71702 BP876672 BI926988 SRR015436.126562 DB683347 BP877626 BG627802 AI777432 SRR015436.143342 SRR015435.22837 DB695151 SRR015436.89539 SRR015435.354946 SRR015436.129326 BG630096 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 818884 |
| Trichome-related Gene from Literature | 818884 |