| Detail of EST/Unigene TCSL76079 |
| Acc. | TCSL76079 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 3-ketoacyl-CoA synthase 6 OS=Arabidopsis thaliana E-value=0; 3-ketoacyl-CoA synthase 5 OS=Arabidopsis thaliana E-value=0; 3-ketoacyl-CoA synthase 9 OS=Arabidopsis thaliana E-value=0; 3-ketoacyl-CoA synthase 4 OS=Arabidopsis thaliana E-value=0; 3-ketoacyl-CoA synthase 19 OS=Arabidopsis thaliana E-value=2e-93; |
| Length | 1169 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015435 (42 ESTs); SRR015436 (15 ESTs); SL_flower_buds8 (1 ESTs); |
| Sequence | GGCCATTACGGCCGGGGATTCATCCTTTCTTCTTTTCACTTGTAATATTTTTTTATTCTT |
| EST members of Unigene | SRR015436.300700 SRR015435.317800 SRR015435.290653 SRR015436.300278 SRR015435.295104 SRR015435.313504 SRR015435.326862 SRR015435.304566 AW623011 SRR015435.93855 SRR015435.286908 SRR015436.75999 SRR015436.89532 SRR015435.145058 SRR015435.56516 SRR015435.190553 SRR015436.91371 SRR015436.283013 SRR015436.137695 SRR015436.153074 SRR015435.273833 SRR015435.50324 SRR015436.281115 SRR015435.318396 SRR015435.245529 SRR015435.32445 SRR015435.73583 SRR015435.275561 SRR015435.333140 SRR015435.71362 SRR015435.98628 SRR015435.327741 SRR015435.188270 SRR015436.80937 SRR015435.334332 SRR015435.101728 SRR015436.332529 SRR015435.46477 SRR015436.283256 SRR015435.281598 SRR015435.216251 SRR015435.337605 SRR015435.43541 SRR015435.231805 SRR015435.258572 SRR015435.61077 SRR015435.214756 SRR015435.1608 SRR015435.201720 SRR015436.297436 SRR015435.199963 SRR015436.95985 SRR015435.321165 SRR015435.201307 SRR015435.323673 SRR015436.127407 SRR015435.337639 SRR015435.102519 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 843182 |
| Trichome-related Gene from Literature | 843182 |