| Detail of EST/Unigene TCSL76810 |
| Acc. | TCSL76810 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | WRKY transcription factor 6 OS=Arabidopsis thaliana E-value=3e-58; Probable WRKY transcription factor 31 OS=Arabidopsis thaliana E-value=2e-57; Probable WRKY transcription factor 42 OS=Arabidopsis thaliana E-value=2e-56; Probable WRKY transcription factor 47 OS=Arabidopsis thaliana E-value=7e-25; Probable WRKY transcription factor 72 OS=Arabidopsis thaliana E-value=4e-21; |
| Length | 1039 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015436 (13 ESTs); SRR015435 (12 ESTs); SL_TAMU_CALLUS (5 ESTs); SL_MicroLEAF3 (3 ESTs); SL_CROWNGALL (1 ESTs); LIBEST_024426 (1 ESTs); SL_MicroFRUIT (1 ESTs); SL_CALLUS (1 ESTs); |
| Sequence | GGCCATTACGGCCGGGGACTTCTTAGACTCTTCAATTTATCATATTTCTATCTCTACCTT |
| EST members of Unigene | SRR015436.157871 SRR015436.183855 DB700558 SRR015436.295838 FS183391 SRR015436.86066 SRR015435.270852 SRR015436.115115 SRR015435.216008 SRR015436.299654 DB688124 DB716246 SRR015436.268641 SRR015436.238073 BI921208 SRR015435.296306 AW032133 SRR015436.200731 SRR015435.110711 AW031052 SRR015435.327524 SRR015435.178481 SRR015435.319198 SRR015435.74390 DB689737 AW030333 SRR015436.276040 SRR015435.259558 SRR015436.76625 BG132282 SRR015435.104314 SRR015435.95401 AW032231 SRR015436.88662 SRR015435.37793 AW034372 SRR015436.278667 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | WRKY |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 842527 |
| Trichome-related Gene from Literature | 842527 |